No Slide Title

[Audio] Molecular Identification of Crape Myrtle Powdery Mildew Pathogen Ainong Shi, Margaret Mmbaga and Suping Zhou Tennessee State University.

Crape myrtle tree and flowers. IMG_0435. Crape myrtle tree and flowers.

Crape myrtle powdery mildew. Powdery mildew is the most commonly recognized disease of crape myrtle (Hagan 2004). Erysiphe lagerstroemiae has been reported as the cause agent in the USA (West 1933, Sinclair et al. 1987, Hagan 2004). Uncinuliella australiana was reported as the causal pathogen in China, Japan and Australia (Zheng & Chen 1979, Zhou 1985, Takamatsu et al 1998, Cunnington et al 2004). E. australiana, U. australiana, and Phyllactinia guttata were the pathogen of powdery mildew in crape myrtle (Farr et al. 1989).

[Audio] Questions: Is the causal pathogen of crape myrtle powdery mildew the same between U-S-A and China, Japan and Australia. How many pathogens cause the powdery mildew disease in crape myrtle? Because cleistothecia and ascocarp are rarely developed, it is hard to identify the causal pathogen of powdery mildew in crape myrtle by mycelia and conidia..

[Audio] Internal Transcribed Spacer (I-T-S--) region has been widely used in identifying and distinguishing pathogens for fungal diseases in plants. Thousands of sequences of I-T-S region from fungi have been published in GenBank. Because the polymorphisms are very few among fungi amplified from the universal primers, designing specific primers from I-T-S region has been widely used as molecular markers to identify, distinguish and detect specific pathogens in plant diseases..

[Audio] Objectives: Identify the causal pathogen for powdery mildew in crape myrtle Develop species specific primers for the pathogen Detect the pathogen by specific primers.

[Audio] I-T-S universal primer analysis A four step procedure Extraction of D-N-A PCR Amplification PCR Product Sequence Sequence Similarity Analysis.

DNA Extraction. Genomic DNA was extracted by use of the DNeasy Plant Mini Kit from the mycelia and conidia of powdery mildew..

[Audio] P-C-R Amplification Its1-f/its4 ITS universal primers: ITS1-F: cttggtcatttagaggaagtaa I-S-T-4-: tcctccgcttattgatatgc 704bp al1 al1 The P-C-R product is 704bp amplified from the primer pair ITS1-F/ITS4..

[Audio] P-C-R Product Sequence Cttggtcatttagaggaagtaaaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattactgagcgtgtgagaccagccgtcgtggcatct Gctacgtgcgcgctgcgtcgaacccctccacccgtgccgactttaatgttttgttgctttggcggaccggactcattcgctgttgcgttgtgaggccacc Ggcttaggctggagcgcgtccgccagagacttagcccaactcgtgttgtcatatagtctaaggttttttaaatataaataaaactttcaacaacggatct Cttggctctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaatttagtgaatcatcgaatctttgaacgcacattgcgcccc Ttggtattccgaggggcatgcctgttcgagcgtcatatcaaccctctctcgagccactgtttgtgtggctgcggtgttggggctcgtcgatcaaactaga Ccgacggcccttaagacaagtggcggtctcggtgtaggctctacgcgtagtatttgtttctcgcgacagaacgacactgatggctggccaaaggataaac Gaagcaagaaattgtgtcgcagccgcggcgcgattttaatcaaaggttgacctcgaatcaggtagggatacccgctgaacttaagcatatcaataagcgg Agga A part of the sequence from the P-C-R product amplified from ITS1/ITS4.

[Audio] Sequence Analysis Pathogen Disease Primer pair Sequence length CG% Erysiphe pulchra Dogwood powdery mildew ITS1/ITS4 642bp 54.05 Microsphaera syringae japonicae Lilac powdery mildew ITS1/ITS4 645bp 54.42 Uncinuliella australiana Crape myrtle powdery mildew ITS1/ITS4 666bp 51.05.

[Audio] Similarity Analysis BLAST Search Query: 39 tccgtaggtgaacctgcggaaggatcattactgagcgtgtgagaccagccgtcgtggcat 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 tccgtaggtgaacctgcggaaggatcattactgagcgtgtgagaccagccgtcgtggcat 60 Query: 99 ctgctacgtgcgcgctgcgtcgaacccctccacccgtgccgactttaatgttttgttgct 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ctgctacgtgcgcgctgcgtcgaacccctccacccgtgccgactttaatgttttgttgct 120 …………………………………………………………………………………………………………………………………………………………… …………………………………………………………………………………………………………………………………………………………… Query: 639 atcaaaggttgacc ……… cccgctgaacttaagcatatcaataagcggagga 704 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 601 atcaaaggttgacc ……… cccgctgaacttaagcatatcaataagcggagga 666 Query – from our data Sbject – Uncinuliella australiana in GenBank 666/666 (100%) identities Primer Sequence (5’  3’) reversal sequence ITS1 tccgtaggtgaacctgcgg IST4 tcctccgcttattgatatgc gcatatcaataagcggagga.

[Audio] Specific Primer Analysis Primer design PCR test for primers and Specific primer identification Sequence to verify specificity Detection of pathogen.

[Audio] Primer Design 1 10 20 30 40 50 Cttggtcatttagaggaagtaaaagtcgtaacaaggtttccgtaggtgaa Cctgcggaaggatcattactgagcgtgtgagaccagccgtcgtggcatct Gctacgtgcgcgctgcgtcgaacccctccacccgtgccgactttaatgtt Ttgttgctttggcggaccggactcattcgctgttgcgttgtgaggccacc Ggcttaggctggagcgcgtccgccagagacttagcccaactcgtgttgtc Atatagtctaaggttttttaaatataaataaaactttcaacaacggatct Cttggctctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtg Aattgcagaatttagtgaatcatcgaatctttgaacgcacattgcgcccc Ttggtattccgaggggcatgcctgttcgagcgtcatatcaaccctctctc Gagccactgtttgtgtggctgcggtgttggggctcgtcgatcaaactaga Ccgacggcccttaagacaagtggcggtctcggtgtaggctctacgcgtag Tatttgtttctcgcgacagaacgacactgatggctggccaaaggataaac Gaagcaagaaattgtgtcgcagccgcggcgcgattttaatcaaaggttga Cctcgaatcaggtagggatacccgctgaacttaagcatatcaataagcgg Agga Primer name Sequence (5’ to 3’) Location ITS1-F cttggtcatttagaggaagtaa 1-22 I-T-S-1 tccgtaggtgaacctgcgg 39-58 I-T-S-4 tcctccgcttattgatatgc 704-685 ua f1 ccgtgccgactttaatgttt 132-151 ua f2 Tagcccaactcgtgttgtca 232-251 ua f3 gcccaactcgtgttgtcata 234-253 ua r1 gcgtagagcctacaccgaga 546-527 ua r2 cgcgagaaacaaatactacgc 565-545 ua r3 cgacacaatttcttgcttcgt 619-599 ua r4 ccatcagtgtcgttctgtcg 583-564.

[Audio] Primer Amplification Amplification pattern of D-N-A detecting 13 primer pairs in U australiana: ITS1-F/ITS4, ua f1/ua r1, ua f1/ua r2, ua f1/ua r3, ua f1/ua r4, ua f2/ua r1, ua f2/ua r2, ua f2/ua r3, ua f2/ua r4, ua f3/ua r1, ua f3/ua r2, ua f3/ua r3, and ua f3/ua r4. Lane M is a 100bp molecular weight marker. M 1 2 3 4 5 6 7 8 9 10 11 12 13 M.

[Audio] Specific primer for detection of the pathogen The polymorphic band showed in all tested crape myrtle powdery mildew samples. The size of band is 385bp from ua f3/ua r3. Sequence data from the P-C-R amplified from the specific primer pair ua f1/ua r3 is identical to that in I-T-S region of U australiana. 385bp The results indicated that U australiana was the pathogen of powdery mildew in crape myrtle in middle Tennessee..

[Audio] Comparison with other powdery mildew pathogens Crape myrtle Dogwood Lilac.

[Audio] Specific primers for E pulchra of dogwood Powdery mildew M 1 2 3 4 5 6 7 8 9 M Lane 1, 4, 7 are Cornus florida Lane 2, 5, 8 are Erysiphe pulchra Lane 3, 6, 9 are Phyllactinia guttata M is 100bp ladder..

[Audio] Specific Primers for P guttata of Dogwood powdery mildew M 1 2 3 4 5 6 7 8 9 10 11 12 M Lane 1, 4, 7, 10 are Cornus florida Lane 2, 5, 8,11 are Erysiphe pulchra Lane 3, 6, 9, 12 are Phyllactinia guttata M is 100bp ladder..

[Audio] Specific Primers M syringae japonicae of lilac powdery mildew 1 2 3 M The polymorphic band showed only for Microsphaera syringae japonicae (lane 2 on left picture) in three materials; Erysiphe pulchra 2. Microsphaera syringae japonicae 3. Uncinuliella australiana..

[Audio] Specific Primers U australiana of crape myrtle powdery mildew M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M ? Narrow vertical The polymorphic bands only for U australiana (lane 2, 6, 10, and 14) in four D-N-A groups: Lagerstroemia indica, (2) U australiana, (3) Erysiphe Pulchra, and (4) Microsphaera syringae japonicae.

[Audio] Summary Uncinuliella australiana was the causal pathogen of powdery mildew in crape myrtle in middle Tennessee. The size of polymorphic band was 666bp amplified from the primer pair ITS1/ITS4 and 704bp from ITS1-F/ITS4. The species specific primer pairs can be used to detect the pathogen U. australiana in crape myrtle powdery mildew and distinguish it from other powdery mildew pathogens in nursery crops..

[Audio] Question: Erysiphe lagerstroemiae = Uncinuliella australiana ? = Erysiphe australiana ?.

[Audio] Acknowledgements Supervisor: Dr Margaret Mmbaga Dr Suping Zhou Lab Team: Dr Emmanuel Nnodu Dr Frank Mrema, Dr Mario Keri Others: Dr Nick Gawel, Dr Roger Sauve Dr Sandra Reed, Dr Klopfenstein..

[Audio] Thank you! Thank you for taking part in my presentation! Thank all of you!.